We've moved!
The HGVS Nomenclature is now at https://hgvs-nomenclature.org/.
This site contains an archive of varnomen.hgvs.org and is no longer maintained.
a sequence change where, compared to the reference sequence, one or more nucleotides are inserted and where the insertion is not a copy of a sequence immediately 5'
Description
Format: “prefix”“positions_flanking”“ins”“inserted_sequence”, e.g. g.123_124insAGC
“prefix” = reference sequence used = g. “positions_flanking” = position two nucleotides flanking insertion site = 123_124 “ins” = type of change is an insertion = ins “inserted_sequence” = inserted sequence = AGC 1
Note
prefix reference sequences accepted are g., m., c. and n. (genomic, mitochondrial, coding DNA and non-coding DNA).
the “positions flanking” should contain two flanking nucleotides, e.g. 123 and 124 but not 123 and 125.
1 = see Uncertain; when the postion and/or the sequence of an inserted sequence has not been defined, a description may have a format like g.(100_150)ins(25)
the “positions_flanking” should be listed from 5’ to 3’, e.g. 123_124 not 124_123
tandem duplications are described as a duplication (g.123_456dup), not an insertion (g.456_457ins123_456, see Prioritization)
inverted duplications are described as insertion (g.234_235ins123_234inv), not as a duplication (see Inversion)
two variants separated by one or more nucleotides should be described individually and not as a “delins”
exception: two variants separated by one nucleotide, together affecting one amino acid, should be described as a “delins”
NOTE: the SVD-WG has prepared a proposal to modify this recommendation (see SVD-WG010). The new proposal is: two variants that are separated by two or fewer intervening nucleotides (that is, not including the variants themselves) should be described as a single “delins” variant
for all descriptions the most 3’ position possible of the reference sequence is arbitrarily assigned to have been changed (3’rule)
the “inserted_sequence” can be given as the nucleotides inserted (e.g. insAGC) or, for larger insert sequences, by referring to the sequence in the reference sequence (e.g. c.849_850ins858_895) or another reference (e.g. NC_000002.11:g.47643464_47643465ins[NC_000022.10:g.35788169_35788352]). When the inserted sequence is not present in the reference genome it should be submitted to a database (e.g. GenBank) and the accession.version number obtained to refer to it.
1 = see Uncertain; when the postion and/or the sequence of an inserted sequence has not been defined, a description may have a format like g.(100_150)insN[25]
the insertion of a copy of an Alu-repeat sequence (from chromosome 4 nucleotides g.106370094 to g.106370420), and a stretch of 26 A nucleotides, between nucleotides g.10791926 and g.10791927 on chromosome 6.
insertion of inverted duplicated copies
NM_004006.2:c.849_850ins850_900inv
a copy of nucleotides c.850 to c.900 is inserted, in inverted orientation, 5’ of the original sequence, between nucleotide c.849 and c.850
NM_004006.2:c.900_901ins850_900inv
a copy of nucleotides c.850 to c.900 is inserted, in inverted orientation, 3’ of the original sequence, between nucleotide c.900 and c.901
LRG_199t1:c.940_941ins[885_940inv;A;851_883inv]
an inverted copy of nucleotides c.851 to c.940, with a G>A substitution of nucleotide c.884, is inserted directly 3’ of the original sequence
NM_004006.2:c.940_941ins[903_940inv;851_885inv]
an inverted copy of nucleotides c.851 to c.940, with a deletion from nucleotides c.886 to c.902, is inserted directly 3’ of the original sequence
incomplete descriptions, preferably use exact descriptions only
NM_004006.2:c.(222_226)insG
the insertion of a G at an unknown position in the sequence encoding amino acid 75
NC_000004.11:g.(3076562_3076732)insN[12]
the insertion of 12 nucleotides (not specified) at an unknown position between nucleotides g.3076562 and g.3076732 (exon 1 of the HTT gene containing the Gln/Pro repeat region)
the insertion of an undefined sequence of 543 nucleotides (N[543]), and a 12 nucleotide target site duplication (g.8897743 to g.8897754), between nucleotides g.8897754 and g.8897755 on chromosome 6.
the insertion of a sequence from the X-chromosome (NC_000023.10), maximally involving nucleotides 12345_45678 but certainly nucleotides 23456_34567, at an unknown position (g.?_?) in the genome (see Uncertain)
Q&A
Can I describe a variant as g.123insG?
No, since the description is not unequivocal it is not allowed. What does the description mean, the insertion of a G at position 123 or the insertion of a G after position 123? The situation becomes even more complex when using a coding DNA reference sequence a "-" character is used, e.g. c.-14insG or c.456-13insG. In the description c.456-13insG, when the insertion is after intronic nucleotide c.456-13, is this position c.456-12 or c.456-14?
Can I use the "^" character to describe an insertion?
No, insertions can not be described using the format g.123ˆ124insG or g.123ˆ124G. The recommendations try to restrict the number of different characters used to a minimum. Since a character was already used to indicate a range (the underscore) a new character was not required.
How should I describe the change ATCGATCGATCGATCGAGGGTCCC to ATCGATCGATCGATCGAATCGATCGATCGGGTCCC? The fact that the inserted sequence (ATCGATCGATCG) is present in the original sequence suggests it derives from a duplicative event.
The variant should be described as an insertion; g.17_18ins5_16. A description using "dup" is not correct since, by definition, a duplication should be directly 3'-flanking of the original copy (in tandem). Note that the description given still makes it clear that the sequence inserted between g.17 and g.18 is probably derived from nearby, i.e. position g.5 to g.16, and thus likely derived from a duplicative event.
A variant in the CDKN2A gene, duplicating the first 24 nucleotides of the coding DNA reference sequence, has been described as c.23ins24. My interpretation is it should be described as c.1_24dup, is this correct?
Since the sequence in that region si cagcATGGAGCCGGCGGCGGGGAGCAGCATGGAGCCTTCG.. the correct decription is c.9_32dup (p.(Ala4_Pro11dup)). c.1_24dup seems correct but neglects the 3'rule (3' shift possible for the underlined region). c.23ins24 is not correct since the position of the insertion is not described properly and because ins"24" does not define the sequence inserted.