We've moved!
The HGVS Nomenclature is now at https://hgvs-nomenclature.org/.
This site contains an archive of varnomen.hgvs.org and is no longer maintained.
a sequence change between the translation initiation (start) and termination (stop) codon where, compared to a reference sequence, translation shifts to another reading frame.
Description
Format: “prefix”“amino_acid”position”new_amino_acid”“fs”“Ter”“position_termination_site”, e.g. p.(Arg123LysfsTer34)
“prefix” = reference sequence used = p. “amino_acid” = first amino acid changed = Arg “position” = position = 123 “new_amino_acid” = new amino acid = Lys “fs” = type of change is a frame shift = fs “Ter” = termination codon = Ter / * “position_termination_site” = position new termination site = 34
Note
all variants should be described at the DNA level, descriptions at the RNA and/or protein level may be given in addition
prefix reference sequence accepted is “p.” (protein).
predicted consequences, i.e. without experimental evidence (no RNA or protein sequence analysed), should be given in parentheses, e.g. p.(Arg123LysfsTer34).
for all descriptions the most C-terminal position possible of the reference sequence is arbitrarily assigned to have been changed (3’rule)
frame shifts are a special type of amino acid deletion/insertion which, by definition, do not include the deletion from the site of the change to the C-terminal end of the protein (translation termination (stop) codon), like “Arg123_Leu833del”, nor the amino acid sequence inserted.
the description of a frame shift starts with the first new amino acid, this might not be first codon affected by the variant at the DNA level
the position of the translation termination (stop) codon in the new reading frame is calculated starting at the first amino acid changed by the frame shift (codon 1), and ending at the first stop codon encountered (Ter# or *#)
NOTE: the number of amino acids in the new C-terminal sequence is “#-1” amino acids
NOTE: the shortest frame shift variant possible contains “fsTer2”; variants which introduce an immediate translation termination (stop) codon are described as nonsense variant, e.g. p.Tyr4Ter (or PTyr4*) not p.Tyr4TerfsTer1 (see Substitution).
frame shifts can also be described using a short format; p.Arg123fs i.e. indicating the first amino acid changed, its position and “fs” without further detail.
the (predicted) amino acid changes of additional variants on the same allele (in cis) downstream of the frame shift are not described unless they change the amino acid sequence or length of the shifted reading frame (i.e. introduce an amino acid substitution, an earlier translational termination (stop) codon or affect the termination codon of the shifted frame).
deletions starting 5’ of and including the translation termination (stop) codon are described as frame shift
inserted sequences at DNA or RNA level
extending the amino acid sequence at the C-terminal end with one or more amino acids are described as Extension
containing a translation stop codon in the inserted sequence are described as an insertion, not as a deletion-insertion removing the entire C-terminal amino acid sequence
encoding an open reading frame but after the DNA insertion shifting to another reading are described as a frame shift
a variant with Arg97 as the first amino acid changed, shifting the reading frame, replacing it for a Pro and terminating at position Ter23.
p.(Tyr4*)
the predicted consequence at the protein level of the variant ATGGATGCATACGTCACG.. to ATGGATGCATA\_GTCACG (c.12delC) is a Tyr to translation termination codon.
NOTE: the variant is described as a substitution, not as a frame shift (p.Tyr4TerfsTer1)
p.Glu5ValfsTer5 (short p.Glu5fs)
the predicted consequence at the protein level of the variant ATGGATGCATACGAGATGAGG to ATGGATGCATACGTGCATACGAGATGAGG.. (c.6_13dup).
p.Ile327Argfs*? (short p.Ile327fs)
the predicted consequence of a frame shifting variant changes Ile327 to an Arg but the new reading frame does not encounter a new translation termination (stop) codon
p.Gln151Thrfs*9 (not p.His150Hisfs*10)
the first codon at the DNA level affected by a variant is His150 and the shifted frame starts with a HisThrSer…. Since frame shift variants start with the first amino acid changed the description p.His150Hisfs*10 (or p.His150HisfsTer10) is not correct.
Q&A
What do you mean with "variants should be described on the protein level and not incorporate knowledge regarding the change at the DNA-level"?
It means that protein variant descriptions should be derived from comparing the variant protein sequence with the reference protein sequence. Knowledge on the underlying change at the DNA level should not be used. E.g. when MetTrpSerSerSerHisAsp.. changes to MetTrpSerSer_HisAsp.. this is described as p.Ser5del. The information that at the DNA level the change is ..ATGTGGTCCAGTTCCCACGAT.. to ..ATGTGGTCC_TCCCACGAT.., so the codon for Ser4 is deleted, is not used; the description p.Ser4del is not correct.